Piltdown Hoax

1. Plitdown man turns out to be paleoanthropological Hoax which fragment remains were found and were presented as fossil remains from an early unknown human. The bones that were found were the skull and the jawbones. It was 1912 when these bones were found in Plitdown, East Sussex, England. This finding took forty years, from discovery time to full exposure this is also significant because it is the one of the main issues that helped with human evolution. This finding had a huge effect on the scientific community because it helped better understand things. Also Charles Dawson was the finder of these fossils. Scientist had a very clear response to the Piltdown man in the earlier years of the finding, like it was hard to understand and follow in the human path of evolution, because it didn't fit like fossils that were found in other places. After years of trying to figure out how this fits, it turned out to be fraud. 
2. One of the the biggest faults is that it took forty years for it to be fully exposed, in my opinion they should have first exposed it and had all the other scientist help them figure it out. The hardest part about the Plitdown man was to try to put it together and that it did not follow the normal path of humans. These hardships were the biggest negative impact on the exposure of the man and how long it took for us to fully understand that this was a fraud. scientist should be held to a standard where they are required to share their findings without a time frame, and with that one of the other scientist would have found out what was happening and would have never let dawson publish it. 
3. The Pltdown man was fraud, turned out that the skull was from a human and the jaw was from an ape. Two little things had scientist going crazy in how this fit into our evolutionary path. The only positive outcome from finding out that the man was a fraud was that it helped us better analysis before spending long years trying to figure it out.  
4. Removing the human factor from science would be the worst thing to do. Yes we are humans we make mistakes we are not perfect. Humans are the biggest part of science and helping science better understand what happened in the past with animals and humans. To prevent errors like this one all we have to do is open our eyes and watch out. That is it, not remove humans from science. 
5. We get life lessons every single day of our lives, and the biggest lesson that I got from the plitdown man is that never trust anything without full evidence that this is true. Because once one person believes and starts to spread it to the others, pretty soon everyone will believe it and not ask for the evidence behind it. We should always expect to have evidence for any little new discovery. 

Week #4

Dentition Patterns

1. Lemurs

Lemurs are one of the small monkeys that live on trees. Lemurs are not dominant in the monkey scale, they have other monkeys that are older and have better traits than they do. They are primary residence of Madagascar. They eat insects, lizards and eggs. they have a dental formation of 2.1.3.3.

Which is 2- incisors 1- canine 3- premolars and 3-premolars. Their dental formation is unique because it is made up of both incisors and canine giving it a special name "dental comb." Lemurs are great in grooming and eating because of their dental comb, makes it easier to groom and grab their foods. their teeth are the only things that helps them get their food.



     2. Spider Monkeys

Spider Monkeys live in the tropical Venezuela and Colombia. They mostly eat fruits and nuts which is why they stay in higher trees. Spider monkeys have the same pattern as Lemurs do. 2.1.3.3, their teeth have adapted to their life style. Living in the trees protect them from any of their predators. living in the trees the spider monkey had to learn to eat nuts and fruits hence their diet of fruit and nuts the most thing trees grow.


      3. Baboons

Baboons are more likely to be found in the grasslands looking for food or sleeping/lounging in trees without leaves or on cliffs. Their dental formation is close to the other but just a bit different. 2.1.2.3 The incisors are for ripping off pieces of food and the canine if for tearing the food apart. They live in large groups which causes them to become more aggressive when it comes to eating they rip and tear their food apart in order to swallow it because the faster its in their stomachs the better.


      4. Gibbon

Gibbons Are mostly in the southeast part of Asia, they are the smallest ones of the apes and live on the way top of the trees. They are very tiny apes weighing 12 to 20 pounds and as tall as 3 feet. Gibbons are becoming more like pets to humans than they are wild. They have a short jaw and their dentition is the same as baboons, 2.1.2.3. Because they are so small they spend most of their days in trees and their as well as teeth have evolved to eating fruits and figs.


      5. Chimpanzees

They live in groups as big as 10 which are lead by a male the alpha male. They are mot likely to be found in central and west Africa. Their dentition is the same as gibbons and baboons, 2.1.2.3. They also eat fruits and leaves but sometimes they eat other things. They have a wide mouth space in order to grab as much food as they can.


Summary: In all of my research it seems clear that their dentition is effected mostly by their environment that they live in and what they eat, Chimpanzees, gibbons, and baboons all have the same pattern and all three eat the same things. Like spider monkeys and lemurs they have the same patterns too. Each primate has adapted to their own environment as best as they can. They all may seem the same but they do have their differences in several ways. 

Week 3 Anthropology

1)   Homologous traits

                 

 A)     Humans and monkeys have a lot of the same traits, but the one that I am talking about is the tailbone. Even though humans don’t have tails, we still have the tailbone.

B.     Humans don’t have a tail physically showing, but we still have the bone and it is in the same structure as the monkey has. The tailbone in a human is the last part of where the tail would be. The only difference between us is that we have the bone for it, but don’t actually have the tail coming out, the monkeys do.

C.     Primates are both of their ancestors, primates also had a tail bone and a tail.

2)   Analogous traits

A.     Penguins and dolphins both have fins. Having fins doesn’t make them related in some way.

B.     They both look exactly the same just on different body parts for both animals. The penguin has two fins on the side of them used as wings and the dolphin has one their back used to swim throughout the water.

C.     The penguin’s ancestors are birds and the dolphin’s ancestors are mammals. The birds of course had fins because penguins ended up with them, but mammals did not have any fins in the past ancestors they had.

                                                                        

DNA Code

GCTACCACGGTAGTGGCTTGACGTGCCCGCGGTAAATCAT